AOL Search

Skip over navigation
enhanced by Google

Web Results

1 - 10 of about 10,600

Web Results

  • [PDF]

    Gene expression and regulation

    Mar 21, 2005 ... a consensus sequenceconsisting of TAATAT at the -10 region and TTGACA at the -. Gene Expression and Regulation. 193. ATCCTGTCTACGTATAAATACGC ...

    www.blackwellpublishing.com/trun/pdfs/Chapter12.pdf - Similar

  • Gene Expression and Regulation | Learn Science at Scitable

    How can a gene, consisting of a string of DNA hidden in the nucleus, know when it should express itself? How does the gene cause production of a string of ...

    www.nature.com/scitable/topic/Gene-Expression-and-Regulati... - Similar

  • Gene

    Gene Expression and Regulation. The term "gene" refers to a functional segment of DNA, which in eukaryotic cells would be a part of a chromosome. ...

    hyperphysics.phy-astr.gsu.edu/HBASE/Biology/gene.html - Similar

FeedbackClose

Great! Please tell us what you found most helpful.

We're sorry. Please tell us what went wrong.

New! Get help with our search tips

Upgrade NOW to IE8

Free, Safer & Faster!

Click Here
© 2009 AOL LLC. All Rights Reserved.