|
enhanced by Google
|
Mar 21, 2005 ... a consensus sequenceconsisting of TAATAT at the -10 region and TTGACA at the -. Gene Expression and Regulation. 193. ATCCTGTCTACGTATAAATACGC ...
www.blackwellpublishing.com/trun/pdfs/Chapter12.pdf - Similar
How can a gene, consisting of a string of DNA hidden in the nucleus, know when it should express itself? How does the gene cause production of a string of ...
www.nature.com/scitable/topic/Gene-Expression-and-Regulati... - Similar
Gene Expression and Regulation. The term "gene" refers to a functional segment of DNA, which in eukaryotic cells would be a part of a chromosome. ...
hyperphysics.phy-astr.gsu.edu/HBASE/Biology/gene.html - Similar
Analyzing Gene Expression and Regulation 07/2007. Sample & Assay Technologies. 3 . Broad range of solutions for studying genes. The ground-breaking invention ...
www1.qiagen.com/literature/render.aspx?id=23629 - Similar
Liu, X., Yu, X., Zack, D.J., Zhu, H., Qian, J. (2008) TiGER: a database for tissue-specific gene expression and regulation. BMC Bioinformatics. 9:271. ...
bioinfo.wilmer.jhu.edu/tiger/ - Similar
Gene Expression and Regulation Program members are engaged in identifying genes and genetic mechanisms involved in cancer and other diseases, ...
www.wistar.org/research_facilities/geneexpress.html - Similar
The approaches to study gene expression and regulation vary from the atomic level to the molecular level to the population level, and this depth of ...
www.ns.msu.edu/genetics/ResearchAreas/geneexpression.htm - Similar
Gene Expression and Regulation and over 360000 other books are available ... Start reading Gene Expression and Regulation on your Kindle in under a minute. ...
www.amazon.com/Gene-Expression-Regulation-Jun-Ma/dp/0... - Similar
Gene Expression and Regulation Group. Sachiyo Kawamoto, MD, PhD, Principal Investigator. My research program primarily investigates the regulatory ...
dir.nhlbi.nih.gov/labs/lmc/mmb/ger/ - Similar
Apr 22, 2004 ... Differential Gene Expression and Regulation of the. Bone Morphogenetic Protein Antagonists Follistatin and ...
doi.wiley.com/10.1002/art.20441 - Similar
Great! Please tell us what you found most helpful.
We're sorry. Please tell us what went wrong.
|
|